All published articles of this journal are available on ScienceDirect.
Impact of 3 Common ABCA1 Gene Polymorphisms on Optimal vs Non-Optimal Lipid Profile in Greek Young Nurses
Abstract
Objective:
This study is in line with two previous ones from our group. They evaluated the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms [such as rs2230806 (R219K), rs2230808 (R1587K) and rs4149313 (I883M)] on the human lipid profile (defined as Optimal and Non-Optimal).
Methods:
The present study included 447 unrelated young women and men self-reported as being healthy and that attended the University of Nursing of Technological and Educational Institution. All subjects were genotyped and the ABCA1 polymorphisms (R219K, R1587K and I883M) were recorded. According to lipid profile [total cholesterol, triglyceride, high-density lipoprotein cholesterol and low-density lipoprotein cholesterol (LDL-C)] the subjects were separated into those with optimal lipid profile (Optimal Group, n=209) and Non-Optimal Group (n=238).
Results:
No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to the lipid profile (p>0.05 in all cases). No statistical differences were observed in the distribution of R219K, R1587K and I883M polymorphisms according to sex (p>0.05 in all cases). However, Logistic Regression revealed that subjects with RK (R1587K polymorphism) genotype had 69% increased risk on average of having LDL-C above normal limits as compared with those with RR genotype. Similarly, subjects with K allele (R1587K polymorphism) had 59% increased risk on average of having LDL-C above normal limits compared with those with R allele.
Conclusion:
These findings suggest that R1587K polymorphism of ABCA1 gene may influence the lipid profile. However, this needs to be confirmed by larger studies.
INTRODUCTION
ATP-binding cassette transporter A1 (ABCA1) mediates the transport of cholesterol and phospholipids from cells to lipid-poor apolipoproteins. Animal and human studies have documented that defects in the ABCA1 pathway are determinants of coronary heart disease (CHD) [1].Inactivation of ABCA1 gene in macrophages increases atherosclerotic lesions in hyperlipidemic mice [2] and overexpressing human ABCA1 in transgenic mice retards atherogenesis [3]. Several ABCA1 gene polymorphisms have been identified, such as rs2230806 (R219K) in the chromosomal position 107620867, rs2230808 (R1587K) in the chromosomal position 106602625 and rs4149313 (I883M) in the chromosomal position 106626574. Clee et al [4] genotyped 804 Dutch men with CHD who participated in the Regression Growth Evaluation Statin Study (REGRESS) and found that K allele carriers had decreased progression of atherosclerosis and a reduced risk of coronary events.
The aim of the study, in line with our previous work [5-7], was to evaluate the R219K, R1587K and I883M of ABCA1 gene polymorphisms according to lipid profile.
MATERIALS AND METHODOLOGY
Subjects
The genotyping of 447 Greek nurses (81% women) aged [median (range)] 22.5 (18.0-57.0) years that attended the University of Nursing of Technological and Educational Institution was performed. All subjects were self-reported as being healthy. The exclusion criteria were: any known chronic disease such as cardiovascular disease, diabetes mellitus, hypertension, hypothyroidism and renal or liver disease. Also, the subjects with professional exercise performance were excluded.
SUBJECT SUBGROUPS
According to Lipid Profile
All subjects were divided to 2 groups according to lipid profile [total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglycerides (TG) and apolipoprotein (apo) A.]
We applied the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults, Adult Treatment Panel III (NCEP ATP III) classification of TC, LDL-C, HDL-C and TG [8]. Optimal lipid profile was defined as TC <2 20 mg/dl, TG <150 mg/dl, HDL-C >40 mg/dl or LDL-C<160 mg/dl. Non-Optimal lipid profile was defined as TC >220 mg/dl, TG >150 mg/dl, HDL-C<40 mg/dl or LDL-C >160 mg/dl.
According to Genotypes
We evaluated single nucleotide polymorphisms (SNPs) in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to lipid profile by using polymerase chain reaction (PCR) and restricted fragment length polymorphism analysis (RFLP’s) (see below).
The University of Nursing of Technological and Educational Institution ethics committee approved the study. All subjects signed an informed consent form.
DNA Analysis and Determination of Blood Lipids
The ABCA1 gene polymorphisms (R219K, R1587K and I883M) were detected using PCR and RFLP’s. The PCR was performed using Taq polymerase KAPATaq.
For R219K polymorphism the oligonucleotide primers which were used were AAAGACTTCAAGGACCCAGCTT and CCTCACATTCCGAAAGCATTA [9]. PCR was subjected to 95οC for 5 min, 30 cycles of 95οC for 30 s, 55οC for 30 s and 72οC for 30 s and final extension to 72οC for 7 min, producing a fragment of 309 bp. This fragment was subsequently cleaved by EcoNI, creating fragments for R allele 309 bp and for K allele 184 bp and 125 bp, which were subjected to electrophoresis on an agarose gel 3% and visualized with ethidium bromide.
For R1587K polymorphism the oligonucleotide primers which were used were AAGATTTATGACAGGACTG GACACGA and TGAATGCCCCTGCCAACTTTAC [10]. PCR was subjected to 95οC for 5 min, 30 cycles of 95οC for 30 s, 60οC for 30 s and 72οC for 30 s and final extension to 72οC for 7 min, producing a fragment of 139 bp. This fragment was subsequently cleaved by BssSI, creating fragments for R allele 117 bp and 22 bp and for K allele 139 bp, which were subjected to electrophoresis on an agarose gel 3% and visualized with ethidium bromide.
The oligonucleotide primers used for I883M polymor-phism were 5’-GAGAAGAGCCACCCTGGTTCCAACCA GAAGAGGAT-3’ and 5’- AGAAAGGCAGGAGACAT CGCTT −3 as described by Clee SM et al [4]. PCR was subjected to 95οC for 5 min, 30 cycles of 95οC for 30 s, 65οC for 30 s and 72οC for 30 s and final extension to 72οC for 7 min, producing a fragment of 132 bp. This fragment was subsequently cleaved by EcorV, creating fragments for I allele 97 bp and 35 bp and for M allele 132 bp, which were subjected to electrophoresis on an agarose gel 4% and visualized with ethidium bromide.
Statistical Analysis
All data except for total and LDL-C deviated from normality (Kolmogorov-Smirnov test). Non-normally distributed continuous variables are shown as median and interquartile range (25th, 75th percentile), while total cholesterol and LDL-C concentrations are presented as mean ± SD (Standard Deviation). All categorical variables are presented as relative (percentage) frequencies. The Kruskal-Wallis H statistic or One Way ANOVA, where appropriate, were used to compare continuous variables among the 3 genotype groups, while the Mann-Whitney U test or the Student’s t-Test, where appropriate, were used to compare the continuous variables between the 2 groups of carriers. All tests were 2-sided at a significance level of p <0.05. Data were analyzed using SPSS™ (Version 11.5, Chicago IL, USA).
RESULTS
Clinical and Laboratory Parameters
Clinical characteristics and laboratory parameters of the study groups are shown in Table 1 and Table 2.
Demographic data.
| Variable | Median (Range) | 
|---|---|
| Age (years) | 22.5 (57.0-18.0) | 
| Height (cm) | 166 (207-150) | 
| Weight (Kg) | 62 (132-40) | 
| BMI (m/Kg2) | 22.3 (44.0-16.0) | 
| Waist (cm) | 88 (143-48) | 
| SBP (mmHg) | 110 (145-80) | 
| DBP (mmHg) | 70 (90-40) | 
| N (%) | |
| Gender | |
| Male | 87 (19.4) | 
| Female | 361 (80.6) | 
| Smoking | |
| Yes | 175 (39.1) | 
| No | 246 (54.9) | 
| Ex-smokers | 26 (6) | 
| Family History of CHD | |
| Yes | 92 (20.5) | 
| No | 296 (66.1) | 
| Not Known | 59 (13.4) | 
BMI = Body mass index, SBP = Systolic blood pressure, DBP = Diastolic blood pressure, CHD = Coronary heart disease
Study group lipid profile.
| Variable | Mean ± SD/Median (Range) | 
|---|---|
| Total Cholesterol (mg/dl) | 202 ± 66 | 
| LDL cholesterol (mg/dl) | 107 ± 46 | 
| HDL cholesterol (mg/dl) | 65 (140-16) | 
| Triglycerides (mg/dl) | 97 (523-12) | 
| Apolipoprotein A (mg/dl) | 147 (200-100) | 
LDL = Low density lipoprotein, HDL = High density lipoprotein
Genotype and allele frequencies in the whole cohort.
| R219K | R1587K | I883M | |||
|---|---|---|---|---|---|
| n (%) | n (%) | n (%) | |||
| RR | 225 (50.2) | RR | 211 (47.1) | II | 309 (69.0) | 
| RK | 191 (42.6) | RK | 193 (43.1) | IM | 131 (29.2) | 
| KK | 32 (7.1) | KK | 44 (9.8) | MM | 8 (1.8) | 
| R | 71.5 | R | 68.6 | I | 83.6 | 
| K | 28.5 | K | 31.4 | M | 16.4 | 
Lipid profile according to 3 ABCA1 gene polymorphisms.
| TC (mg/dl) Mean ± SD | TGs (mg/dl) Median (IQR) | HDL cholesterol (mg/dl) Median (IQR) | LDL cholesterol (mg/dl) Mean ± SD | Apo A1 (mg/l) Median (IQR) | ||
|---|---|---|---|---|---|---|
| R219K | RR | 200±64 | 98 (523-12) | 66 (200-25) | 106±45 | 1.49 (3.0-1.0) | 
| RK | 203±67 | 98 (481-18) | 64 (191-16) | 106±45 | 1.53 (3.0-1.0) | |
| KK | 213±68 | 95 (306-37) | 63 (126 -41) | 122 ±47 | 1.64 (3.0-1.0) | |
| P value | 0.561 | 0.708 | 0.923 | 0.169 | 0.100 | |
| R1587K | RR | 197±67 | 95 (481-12) | 65 (200-24) | 100±45 | 1.45 (3.0-1.0) | 
| RK | 209±61 | 103 (441-12) | 65 (156-16) | 114±43 | 1.48 (3.0-1.0) | |
| KK | 200±76 | 85 (523-25) | 62 (155-30) | 108±53 | 1.43 (3.0-1.0) | |
| P value | 0.185 | 0.395 | 0.735 | 0.011 | 0.848 | |
| I883M | II | 200±67 | 99 (523-12) | 65 (200-16) | 105±47 | 1.4 (3.0-1.0) | 
| IM | 205±62 | 91 (472-30) | 65 (155-33) | 100±42 | 1.5 (3.0-1.0) | |
| MM | 211±63 | 170 (321-42) | 68 (122-41) | 103±38 | 1.5 (2.0-1.0) | |
| P value | 0.740 | 0.486 | 0.818 | 0.633 | 0.574 | 
TC = total cholesterol, LDL = Low density lipoprotein, HDL = High density lipoprotein, TG = triglycerides
The polymorphisms frequency are shown in Table 3 and Table 4.
There was no difference in R219K, R1587K and I883M polymorphisms frequency according to Optimal and Non-Optimal lipid profile (p = 0.49, 0.29 and 0.42, respectively).
Logistic Regression
Subjects with RK (R1587K polymorphism) had 68.8% increased risk on average of having LDL-C above normal limits as compared with those with RR genotype [Odds Ratio (OR): 1.688, p = 0.010, 95% Confidence Intervals (CI) 1.131-2.520.] Similarly subjects with K allele (R1587K polymorphism) had 59% increased risk on average of having LDL-C above normal limits as compared with those with R allele (OR: 1,590, p = 0.016, 95% CI 1.090-2.319).
DISCUSSION
We examined the impact of the R219K, R1587K and I883M of ABCA1 polymorphisms as a genetic influence on the lipid profile in Greek subjects. In this context, the possible effects of the ABCA1 polymorphisms on lipids or cardiovascular disease were recently evaluated in various populations such as Japanese [11] in which correlation with HDL-C concentrations was found, Saudi [12] in which the ABCA1 C69T gene frequency was higher in healthy subjects compared with diabetic patients, Chinese [13], in which ABCA1 gene R219K polymorphism was associated with ischemic stroke, Greek [5-7] in which a gender-specific effect of the R219K polymorphism on plasma lipids was demonstrated, Turkish [14] in which a gender-specific effect of the R219K polymorphism on plasma lipids and CHD was shown and Mexican [15] in which several European loci as well as a novel one for high TG and low HDL-C levels were identified. However, the results are still confusing.
Similarly, the possible influence of ABCA1 gene polymorphisms on Alzheimer disease was previously evaluated. The relationship between ABCA1 R219K, R1587K and I883M and Alzheimer disease has been reported in various ethnic groups with contradictory results. A meta-analysis of 13 studies involving 12,248 subjects did not support the opinion that ABCA1 is a major genetic risk factor for Alzheimer disease [16].
With regard to subgroups with low HDL-C, Hodoğlugil et al. [17] reported that R219K and I883M polymorphisms were related to higher HDL-C levels, Slatter et al. [18] found that R1587K was overexpressed in low HDL-C individuals, whereas Frikke-Schmidt et al. [19] did not observe any association with R219K but reported that R1587K polymorphism was overexpressed in individuals with low HDL-C concentrations. In subgroups with high HDL-C, Kakko et al. [20] found a minor association between ABCA1 polymorphisms and HDL-C levels in women, whereas Clee et al. [4] reported a non-significant trend towards higher HDL-C levels in carriers of R219K. As for TG concentrations, there is also inconsistency between research groups. For example, Clee et al. [4] reported that carriers of K allele of R219K polymorphism had significantly lower TG levels in relation to carriers of the R allele, whereas others did not find any associations. Coban et al. [14] demonstrated the interaction of TG elevation (>140 mg/dL) with CHD in female 219RK genotype carriers. Delgado-Lista et al. [21] reported a trend for lower fasting TG and large TG-rich lipoproteins in minor allele carriers compared with major allele homozygotes of R219K polymorphism. In our study with young Greek nurses (living and working in similar conditions) we did not observe any association of R219K polymorphism with HDL-C or other lipid levels, although we found that individuals with RK genotype of R1587K polymorphism had significantly higher TC, LDL-C and TG levels compared with the RR genotype [7]. These discrepancies may be attributed to environmental factors such as diet, smoking and physical activities. Sandhofer et al. [22] found that K allele of R219K gene displayed a lower intima media thickness and a reduced risk of advanced plaque extent compared with non-carriers only in non-smokers and concluded that smoking abrogates the protective effect of the R219K. Cenarro et al. [23] reported that the K allele of the R219K gene was significantly more frequent in familial hypercholesterolemia subjects without premature CHD than in familial hypercholesterolemia subjects with premature CHD and it appears to be more protective for smokers than non-smokers.
The R1587K polymorphism is located in one of the two extracellular loops of the ABCA1 protein. This location is important for the interaction of apo A1 and for the efflux of cholesterol [19]. In our study, no association between R1587K polymorphism and HDL-C levels was found.
In conclusion, the R1587K polymorphism of ABCA1 gene was associated with altered lipid levels in young Greek nurses. Further research in larger populations is needed to establish such associations and determine their clinical implications.
CONFLICT OF INTEREST
The authors declare that they have no competing interests.
ACKNOWLEDGEMENTS
Declared None.

 
                                                                         
                        